The medium was refreshed after 5 hours of incubation. After two/three days T cells were incubated with RNP composed of recombinant Cas9 (IDT) and a guided RNA (gRNA TRAC: ucaggguucuggauaucugu) against ...
IDT Corp (NYSE:IDT) reported record levels of gross profit, income from operations, and adjusted EBITDA for the second quarter. The company's NRS segment achieved a 32% revenue growth and exceeded ...
ATTORNEYS representing the Industrial Disputes Tribunal (IDT) and two aggrieved employees have challenged a March 2020 Supreme Court ruling which held that the non-judicial body had no ...
Good evening, and welcome to the IDT Corporation's Second Quarter Fiscal Year 2025 Earnings Call. During management's remarks, all participants will be in listen-only mode. [Operator Instructions].
This study reports valuable findings on the role of Layilin in the motility and suppressive capacity of clonal expanded regulatory T cells (Tregs) in the skin. Although the strength of the study is ...
The Cas9 protein is the most widely used by scientists. This protein can easily be programmed to find and bind to almost any desired target sequence, simply by giving it a piece of RNA to guide it ...
After hours: March 14 at 5:30:00 PM EDT Loading Chart for IDT ...
Some results have been hidden because they may be inaccessible to you
Show inaccessible results