The medium was refreshed after 5 hours of incubation. After two/three days T cells were incubated with RNP composed of recombinant Cas9 (IDT) and a guided RNA (gRNA TRAC: ucaggguucuggauaucugu) against ...

1 Day IDT 0.95% DJIA 0.37% S&P Mid Cap 400 -0.04% Telecommunication Services 0.91% ...

Using CRISPR-Cas9 targeting multiple cancer-specific mutations, we developed an innovative approach called cancer-specific insertions and deletions attacker that can induce targeted cancer cell death ...

Prime editing (PE) is a highly versatile CRISPR–Cas9 genome editing technique. The current constructs, however, have variable efficiency and may require laborious experimental optimization. This study ...

CRISPR/Cas9 induces indel mutations in HSV-1 genomes during lytic replication To define the mechanisms of CRISPR-Cas9 editing of lytic genomes, we analyzed the effect of SaCas9/sgRNAs on lytic viral ...

IDT developed a novel mutant of the Acidaminococcus sp. BV3L6 Cas12a (Cpf1), called Cas12a Ultra. The new mutant enzyme has enhanced editing activity, reaching or exceeding the performance of Cas9.

We developed quantitative gene assembly and DNA library insertion into the Saccharomyces cerevisiae genome by optimizing an efficient single-step and marker-free genome editing system using ...